readGeneInput         package:GeneRegionScan         R Documentation

_S_t_a_n_d_a_r_d_i_z_e _r_e_a_d_i_n_g _o_f _g_e_n_e _i_n_p_u_t_s

_D_e_s_c_r_i_p_t_i_o_n:

     Internal function that will standardise the input of the many
     different form of sequences that can be used in Bioconductor.

_U_s_a_g_e:

         readGeneInput(gene, genename=NULL)

_A_r_g_u_m_e_n_t_s:

    gene: 

genename: 

_D_e_t_a_i_l_s:

     This function is not meant to be run directly by the user. It will
     take a number of genes either as a vector  of characters, a path
     to a FASTA format file, as a vector of DNAstrings or as a
     readFASTA format. It will then output  them in FASTA format for
     use with other functions. Optional variable genename forces a new
     name.

     The primary objective of this function is to make the sequence
     input simpler for other functions.

_V_a_l_u_e:

     A list of all sequences and their names, in exactly the same
     format as obtained with the readFASTA function of the Biostrings
     package.

_A_u_t_h_o_r(_s):

     Lasse Folkersen

_S_e_e _A_l_s_o:

     'geneRegionScan','plotOnGene'

_E_x_a_m_p_l_e_s:

             somegene<-"ATACCTTGTAGGACCTGATGATAGATGCATAGTAATATCGTA"
             genename<-"My favourite gene"
             GeneRegionScan:::readGeneInput(somegene,genename=genename)

