getOrfs                package:GeneR                R Documentation

_G_e_t_s _O_R_F_s _f_r_o_m _a _s_e_q_u_e_n_c_e

_D_e_s_c_r_i_p_t_i_o_n:

     Gets ORFs (Open Reading Frames) from a sequence.

_U_s_a_g_e:

     getOrfs(phase = NULL,seqno=0,start="atg",
                        stop=c("taa","tag","tga"), complete = TRUE,suborfs=TRUE)
     maxOrf(seqno=0,phase = NULL,start="atg",
                        stop=c("taa","tag","tga"), complete = TRUE)

_A_r_g_u_m_e_n_t_s:

   seqno: Integer/scalar, Sequence number (buffer number)

   phase: Integer/scalar,. 1,2 or 3, NULL for all three phases

   start: string/vector, start codons

    stop: string/vector, stop codons

complete: Flag: true returns only complet Orfs, else return all Orfs.

 suborfs: Flag: true returns all orfs including subparts of a large orf
          if it exists "atg" in the phase. False: does not returns
          sub-orfs.

_V_a_l_u_e:

     getOrf returns a table of positions. NULL if no Orfs.

     maxOrf returns the size of the largest Orf, -1 if no Orf.

     All functions return NA if error.

_N_o_t_e:

     Reverse strand : not implemented

_A_u_t_h_o_r(_s):

     A. Lucas, Emna Marrakchi and Vincent Lefort

_E_x_a_m_p_l_e_s:

     s<-"gtcatgcatgctaggtgacagttaaaatgcgtctaggtgacagtctaacaa"
     placeString(s)

     getOrfs(phase = NULL,seqno=0)
     maxOrf()

     # To get all ORFs on the reverse strand:
     sc <- getSeq(0,1)
     placeString(sc,seqno=1)
     getOrfs(phase = NULL,seqno=1)

     # All orfs on both strands :
     rbind(getOrfs(seqno=0),getOrfs(seqno=1))

