PlaceString              package:GeneR              R Documentation

_P_u_t _a _c_h_a_r_a_c_t_e_r _s_t_r_i_n_g _i_n_t_o _a _s_e_q_u_e_n_c_e _b_u_f_f_e_r.

_D_e_s_c_r_i_p_t_i_o_n:

     Put a character string into a sequence buffer.

_U_s_a_g_e:

     placeString(s, seqno=0,upper=TRUE)

_A_r_g_u_m_e_n_t_s:

       s: Character string to put into a bufseq

   seqno: Integer. Number of sequence to put the character string
          (bufseq)

   upper: if TRUE: all sequence is converted to upper case (default),
          else sequence is read directly. 

_D_e_t_a_i_l_s:

     Sequence will be available with just the number. Bufseq must be
     empty to put the sequence

_V_a_l_u_e:

     seqno or -1 if error.

_A_u_t_h_o_r(_s):

     L.Cottret

_S_e_e _A_l_s_o:

     'getSeq', 'multiExtract'

_E_x_a_m_p_l_e_s:

     s<-"cgtagtagctagctagctagctagctag"
     placeString (s, seqno=1)
     #[1] 1  
     seqSize()     
     # $sequences
     #[1]  0 29  0  0  0
     #$complementaires
     #[1] 0 0 0 0 0

