| CalculateEfficiencyFISH {DECIPHER} | R Documentation |
Calculates the Gibbs free energy, formamide melt point, and hybridization efficiency of probe/target (DNA/RNA) pairs.
CalculateEfficiencyFISH(probe,
target,
temp,
P,
ions,
FA,
batchSize = 1000)
probe |
A |
target |
A |
temp |
Numeric specifying the hybridization temperature, typically |
P |
Numeric giving the molar concentration of probes during hybridization. |
ions |
Numeric giving the molar sodium equivalent ionic concentration. Values may range between 0.01M and 1M. Note that salt correction is not available for thermodynamic rules of RNA/RNA interactions, which were determined at |
FA |
Numeric concentration (as percent v/v) of the denaturant formamide in the hybridization buffer. |
batchSize |
Integer specifying the number of probes to simulate hybridization per batch. See the Description section below. |
Hybridization of pairwise probe/target (DNA/RNA) pairs is simulated in silico. Gibbs free energies are obtained from system calls to OligoArrayAux, which must be properly installed (see the Notes section below). Probe/target pairs are sent to OligoArrayAux in batches of batchSize, which prevents systems calls from being too many characters. Note that OligoArrayAux does not support degeneracy codes (non-base letters), although they are accepted without error. Any sequences with ambiguity should be expanded into multiple permutations with Disambiguate before input.
A matrix of predicted hybridization efficiency (HybEff), formamide melt point (FAm), and free energy (ddG1 and dG1) for each probe/target pair of sequences.
The program OligoArrayAux (http://mfold.rna.albany.edu/?q=DINAMelt/OligoArrayAux) must be installed in a location accessible by the system. For example, the following code should print the installed OligoArrayAux version when executed from the R console:
system("hybrid-min -V")
Erik Wright eswright@pitt.edu
ES Wright et al. (2014) "Automated Design of Probes for rRNA-Targeted Fluorescence In Situ Hybridization Reveals the Advantages of Using Dual Probes for Accurate Identification." Applied and Environmental Microbiology, doi:10.1128/AEM.01685-14.
probe <- c("GGGCTTTCACATCAGACTTAAGAAACC", "CCCCACGCTTTCGCGCC")
target <- reverseComplement(DNAStringSet(probe))
# not run (must have OligoArrayAux installed first):
## Not run: CalculateEfficiencyFISH(probe, target, temp=46, P=250e-9, ions=1, FA=35)