| motifRankingForSequence,MotifEnrichmentResults-method {PWMEnrich} | R Documentation |
Get a ranking of motifs by their enrichment in one specific sequence
obj |
a MotifEnrichmentResults object |
seq.id |
either the sequence number or sequence name |
bg |
if to use background corrected P-values to do the ranking (if available) |
id |
if to show PWM IDs instead of target TF names |
order |
if to output the ordering of PWMs instead of actual P-values or raw values |
rank |
if the output should be rank of a PWM instead of actual P-values or raw values |
unique |
if TRUE, only the best rank is taken for each TF (only when id = FALSE, order = FALSE) |
... |
currently unused |
a vector of P-values or raw enrichments sorted such that the first motif is most enriched
if(require("PWMEnrich.Dmelanogaster.background")){
###
# load the pre-compiled lognormal background
data(PWMLogn.dm3.MotifDb.Dmel)
# scan two sequences for motif enrichment
sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))
res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)
# most enriched in the second sequences (sorted by lognormal background P-value)
head(motifRankingForSequence(res, 2))
# return unique TFs enriched in sequence 2
head(motifRankingForSequence(res, 2, unique=TRUE))
# sorted by raw affinity instead of P-value
head(motifRankingForSequence(res, 2, bg=FALSE))
# show IDs instead of target TF names
head(motifRankingForSequence(res, 2, id=TRUE))
# output the rank instead of P-value
head(motifRankingForSequence(res, 2, rank=TRUE))
}