| get3pAlignment {scanMiR} | R Documentation |
Performs a local alignment of the miRNA 3' sequence (determined by 'mir3p.start') on given the given sequences.
get3pAlignment( seqs, mirseq, mir3p.start = 9L, allow.mismatch = TRUE, maxMirLoop = 5L, maxTargetLoop = 9L, maxLoopDiff = 4L, TGsub = TRUE, siteType = NULL )
seqs |
A set of sequences in which to look for 3' matches (i.e. upstream of the seed match) |
mirseq |
The sequence of the mature miRNA |
mir3p.start |
The position in 'mirseq' in which to start looking |
allow.mismatch |
Logical; whether to allow mismatches |
maxMirLoop |
Maximum miRNA loop size |
maxTargetLoop |
Maximum target loop size |
maxLoopDiff |
Maximum size difference between miRNA and target loops |
TGsub |
Logical; whether to allow T/G substitutions. |
siteType |
The optional type of seed-complementarity, as returned by
|
A data.frame with one row for each element of 'seqs', indicating the size of the miRNA bulge, the size of the target mRNA bulge, the number of mismatches at the 3' end, and the partial 3' alignment score (i.e. roughly the number of consecutive matching nucleotides)
get3pAlignment(seqs="NNAGTGTGCCATNN", mirseq="TGGAGTGTGACAATGGTGTTTG")