| TsIOList-class {TAPseq} | R Documentation |
TsIOList class is a container to store multiple TsIO objects.
This enables storing of Primer3 input and output for multiple target genes.
TsIOList(...) ## S4 method for signature 'TsIOList' sequence_id(x) ## S4 method for signature 'TsIOList' target_sequence(x) ## S4 method for signature 'TsIOList' sequence_template(x) ## S4 method for signature 'TsIOList' target_annot(x) ## S4 method for signature 'TsIOList' tapseq_primers(x) ## S4 method for signature 'TsIOList' pcr_products(x)
... |
Multiple TsIO objects from which a TsIOList object should be created. |
x |
A |
A TsIOList object.
sequence_id: Get sequence_id
target_sequence: Get target_sequence
sequence_template: Create sequence_template
target_annot: Get target_annot
tapseq_primers: Get tapseq_primers
pcr_products: Get pcr_products
# get example transcript sequences
data("chr11_truncated_txs_seq")
txs_seqs <- chr11_truncated_txs_seq[1:2]
txs_ids <- names(txs_seqs)
# 10x beads-oligo-dt sequence
beads_oligo <- "CTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT"
# reverse primer used in all PCR reactions
reverse_primer <- "CTACACGACGCTCTTCCGATCT"
# create TsIO objects
tsio1 <- TsIO(sequence_id = txs_ids[1], target_sequence = txs_seqs[[1]],
beads_oligo = beads_oligo, reverse_primer = reverse_primer,
product_size_range = c(350, 500))
tsio2 <- TsIO(sequence_id = txs_ids[2], target_sequence = txs_seqs[[2]],
beads_oligo = beads_oligo, reverse_primer = reverse_primer,
product_size_range = c(350, 500))
# create TsIOList object
obj <- TsIOList(tsio1 = tsio1, tsio2 = tsio2)
# it's noteworthy to mention that when creating a TsIOList from a DNAStringSet of target
# sequences, it's easier to use TAPseqInput()
?TAPseqInput
# as with TsIO objects, some values can be accessed using accessor functions
sequence_template(obj)