| plotTopMotifsSequence,MotifEnrichmentResults-method {PWMEnrich} | R Documentation |
Plot the top N enrichment motifs in a single sequence
## S4 method for signature 'MotifEnrichmentResults' plotTopMotifsSequence(obj, seq.id, n, bg = TRUE, id = FALSE, ...)
obj |
a MotifEnrichmentResults object |
seq.id |
either the sequence number or sequence name |
n |
the number of top ranked motifs to plot |
bg |
if to use background corrected P-values to do the ranking (if available) |
id |
if to show PWM IDs instead of target TF names |
... |
other parameters passed to |
if(requireNamespace("PWMEnrich.Dmelanogaster.background")){
###
# load the pre-compiled lognormal background
data(PWMLogn.dm3.MotifDb.Dmel, package = "PWMEnrich.Dmelanogaster.background")
# scan two sequences for motif enrichment
sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"),
DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG"))
res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel)
# plot the top 4 motifs in a 2x2 grid
plotTopMotifsSequence(res, 1, 4)
# plot top 3 motifs in a single row
plotTopMotifsSequence(res, 1, 3, row=1, cols=3)
}