degradeSDs {ModCon}

R Documentation

Remove or degrade intrinisc strength of splice donors while adjusting HZEI integral.

Description

Degrade or remove splice donor sites of certain intrinsic strength (in HBS) from a coding sequence by codon selection.

Usage

degradeSDs(fanFunc, maxhbs=10, increaseHZEI=TRUE)

Arguments

fanFunc	Codon matrix with two rows (see example below)
maxhbs	Numeric treshold which strength of internal donor sites should be degraded
increaseHZEI	Logical value of HZEI integral should be increased or decreased during SD degradation. If TRUE, function aims to increase HZEI integral.

Value

Character value of a nucleotide sequence encoding the same amino acid as the entered codon matrix fanFunc, but the intrinsic strength of all present splice donors (SD) sites is degraded as much as possible, in case they exceed the given treshold maxhbs.

Examples

library(data.table)
## Initiaing the Codons matrix plus corresponding amino acids
ntSequence <- 'TTTTCGATCGGGATTAGCCTCCAGGTAAGTATCTATCGATCTATGCGATAG'
## Create Codon Matrix by splitting up the sequence by 3nt
fanFunc <- createCodonMatrix(ntSequence)
degradeSDs(fanFunc, maxhbs=10, increaseHZEI=TRUE)

---