R: _k_-mer Enrichment between Foreground and Background Sets

calculateKmerEnrichment {transite}

R Documentation

k-mer Enrichment between Foreground and Background Sets

Description

Calls computeKmerEnrichment to compute k-mer enrichment values for multiple foregrounds. Calculates enrichment for foreground sets in parallel.

Usage

calculateKmerEnrichment(foreground.sets, background.set, k,
  permutation = FALSE, chisq.p.value.threshold = 0.05,
  p.adjust.method = "BH", n.cores = 4)

Arguments

`foreground.sets`	list of foreground sets; a foreground set is a character vector of DNA or RNA sequences (not both) and a strict subset of the `background.set`
`background.set`	character vector of DNA or RNA sequences that constitute the background set
`k`	length of k-mer, either `6` for hexamers or `7` for heptamers
`permutation`	if `TRUE`, only the enrichment value is returned (efficiency mode used for permutation testing)
`chisq.p.value.threshold`	threshold below which Fisher's exact test is used instead of Pearson's chi-squared test
`p.adjust.method`	see `p.adjust`
`n.cores`	number of computing cores to use

Value

A list with two entries:

(1) dfs: a list of data frames with results from computeKmerEnrichment for each of the foreground sets (2) kmers: a character vector of all k-mers

Examples

# define simple sequence sets for foreground and background
foreground.set1 <- c(
  "CAACAGCCUUAAUU", "CAGUCAAGACUCC", "CUUUGGGGAAU",
  "UCAUUUUAUUAAA", "AAUUGGUGUCUGGAUACUUCCCUGUACAU",
  "AUCAAAUUA", "AGAU", "GACACUUAAAGAUCCU",
  "UAGCAUUAACUUAAUG", "AUGGA", "GAAGAGUGCUCA",
  "AUAGAC", "AGUUC", "CCAGUAA"
)
foreground.set2 <- c("UUAUUUA", "AUCCUUUACA", "UUUUUUU", "UUUCAUCAUU")
foreground.sets <- list(foreground.set1, foreground.set2)
background.set <- c(foreground.set1, foreground.set2,
                    "CCACACAC", "CUCAUUGGAG", "ACUUUGGGACA", "CAGGUCAGCA")

# single-threaded
kmer.enrichment.values.st <- calculateKmerEnrichment(foreground.sets,
  background.set, 6, n.cores = 1)
## Not run: 
# multi-threaded
kmer.enrichment.values.mt <- calculateKmerEnrichment(foreground.sets,
  background.set, 6)
## End(Not run)