complementSeq           package:Biostrings           R Documentation

_C_o_m_p_l_e_m_e_n_t_a_r_y _s_e_q_u_e_n_c_e.

_D_e_s_c_r_i_p_t_i_o_n:

     WARNING: 'complementSeq' has been deprecated in favor of
     'complement'.

     Function to obtain the complementary sequence.

_U_s_a_g_e:

     complementSeq(seq, start=1, stop=0)

_A_r_g_u_m_e_n_t_s:

     seq: Character vector consisting of the letters A, C, G and T.

   start: Numeric scalar: the sequence position at which to start
          complementing. If 1, start from the beginning.

    stop: Numeric scalar: the sequence position at which to stop
          complementing. If 0, go until the end.

_D_e_t_a_i_l_s:

     The complemented sequence for each element of the input is
     computed and returned.  The complement is given by the mapping: A
     -> T, C -> G, G -> C, T -> A.

     An important special case is 'start=13', 'stop=13': If 'seq' is a
     vector of 25mer sequences on an Affymetrix GeneChip,
     'complementSeq(seq, start=13, stop=13)' calculates the so-called
     _mismatch_ sequences.

     The function deals only with sequences that represent DNA. These
     can consist only of the letters  'A', 'C', 'T' or 'G'. Upper,
     lower or mixed case is allowed and honored.

_V_a_l_u_e:

     A character vector of the same length as 'seq' is returned. Each
     component represents the transformed sequence for the input value.

_A_u_t_h_o_r(_s):

     R. Gentleman, W. Huber

_S_e_e _A_l_s_o:

     'alphabetFrequency', 'reverseComplement'

_E_x_a_m_p_l_e_s:

       ## ---------------------------------------------------------------------
       ## EXAMPLE 1
       ## ---------------------------------------------------------------------
       seq <- c("AAACT", "GGGTT")

       ## Don't do this anymore (deprecated):
       if (interactive()) {
         complementSeq(seq)  # inefficient on large vectors
       }
       ## But do this instead:
       complement(DNAStringSet(seq))  # more efficient

       ## ---------------------------------------------------------------------
       ## EXAMPLE 2
       ## ---------------------------------------------------------------------
       seq <- c("CGACTGAGACCAAGACCTACAACAG", "CCCGCATCATCTTTCCTGTGCTCTT")

       ## Don't do this anymore (deprecated):
       if (interactive()) {
         complementSeq(seq, start=13, stop=13)
       }
       ## But do this instead:
       pm2mm <- function(probes)
       {
           probes <- DNAStringSet(probes)
           subseq(probes, start=13, end=13) <- complement(subseq(probes, start=13, end=13))
           probes
       }
       pm2mm(seq) 

       ## ---------------------------------------------------------------------
       ## SPEED OF complementSeq() VS complement()
       ## ---------------------------------------------------------------------
       if (interactive()) {
         library(hgu95av2probe)
         system.time(y1 <- complementSeq(hgu95av2probe$sequence))
         probes <- DNAStringSet(hgu95av2probe$sequence)
         system.time(y2 <- complement(probes))
       }

