seq2id                 package:lumi                 R Documentation

_T_r_a_n_s_f_e_r _a _n_u_c_l_e_o_t_i_d_e _s_e_q_u_e_n_c_e _a_s _a _n_u_I_D

_D_e_s_c_r_i_p_t_i_o_n:

     The nuID (nucleotide universal identifier) is uniquely
     corresponding to probe sequence. The nuID is also
     self-identification and error checking

_U_s_a_g_e:

     seq2id(seq)

_A_r_g_u_m_e_n_t_s:

     seq: a nucleotide sequence composed of A, C, G, T (U). 

_D_e_t_a_i_l_s:

     The nuID is a exact mapping of nucleotide sequence based on Base64
     encoding scheme.  A character set A-Z, a-z, 0-9, "_" and "." is
     used to represent to the base-64 numbers of 0-63. The first
     character of nuID is a checking code, which provide information of
     both the number of  padded "A"s at the nucleotide sequence and
     error checking. Please refer to reference for more details.

_V_a_l_u_e:

     A string represents nuID

_A_u_t_h_o_r(_s):

     Pan Du

_R_e_f_e_r_e_n_c_e_s:

     Du, P., Kibbe, W.A. and Lin, S.M., "nuID: A universal naming
     schema of oligonucleotides for Illumina, Affymetrix, and other
     microarrays", Biology Direct 2007, 2:16 (31May2007).

_S_e_e _A_l_s_o:

     'id2seq'

_E_x_a_m_p_l_e_s:

     seq <- 'ACGTAAATTTCAGTTTAAAACCCCCCG'
     id <- seq2id(seq)
     id
     id2seq(id)

