R: Utility functions related to sequence alignment

align-utils {Biostrings}

R Documentation

Utility functions related to sequence alignment

Description

A variety of different functions used to deal with sequence alignments.

Usage

  mismatchTable(x, shiftLeft=0L, shiftRight=0L, ...)
  mismatchSummary(x, ...)
  ## S4 method for signature 'AlignedXStringSet':
  coverage(x, start=NA, end=NA, weight=1L)
  ## S4 method for signature 'PairwiseAlignedFixedSubject':
  coverage(x, start=NA, end=NA, weight=1L)
  compareStrings(pattern, subject)
  ## S4 method for signature 'character':
  consensusMatrix(x, freq=FALSE)
  ## S4 method for signature 'XStringSet':
  consensusMatrix(x, baseOnly=FALSE, freq=FALSE)
  consensusString(x)

Arguments

`x`	A `character` vector or matrix, `XStringSet`, `XStringViews`, `PairwiseAlignedFixedSubject`, or `list` of FASTA records containing the equal-length strings.
`shiftLeft, shiftRight`	Non-positive and non-negative integers respectively that specify how many preceding and succeeding characters to and from the mismatch position to include in the mismatch substrings.
`...`	Further arguments to be passed to or from other methods.
`start, end`	See `?coverage`.
`weight`	An integer vector specifying how much each element in `x` counts.
`pattern, subject`	The strings to compare. Can be of type `character`, `XString`, `XStringSet`, `AlignedXStringSet`, or, in the case of `pattern`, `PairwiseAlignedFixedSubject`. If `pattern` is a `PairwiseAlignedFixedSubject` object, then `subject` must be missing.
`baseOnly`	`TRUE` or `FALSE`. If `TRUE`, the returned vector only contains frequencies for the letters in the "base" alphabet i.e. "A", "C", "G", "T" if `x` is a "DNA input", and "A", "C", "G", "U" if `x` is "RNA input". When `x` is a BString object (or an XStringViews object with a BString subject, or a BStringSet object), then the `baseOnly` argument is ignored.
`freq`	If `TRUE`, then letter frequencies (per position) are reported, otherwise counts.

Details

mismatchTable: a data.frame containing the positions and substrings of the mismatches for the AlignedXStringSet or PairwiseAlignedFixedSubject object.

mismatchSummary: a list of data.frame objects containing counts and frequencies of the mismatches for the AlignedXStringSet or PairwiseAlignedFixedSubject object.

compareStrings combines two equal-length strings that are assumed to be aligned into a single character string containing that replaces mismatches with "?", insertions with "+", and deletions with "-".

consensusMatrix computes a consensus matrix for a set of equal-length strings that are assumed to be aligned.

consensusString creates the string based on a 50% + 1 vote from the consensus matrix with unknowns labeled with "?".

Examples

  ## Compare two globally aligned strings
  string1 <- "ACTTCACCAGCTCCCTGGCGGTAAGTTGATC---AAAGG---AAACGCAAAGTTTTCAAG"
  string2 <- "GTTTCACTACTTCCTTTCGGGTAAGTAAATATATAAATATATAAAAATATAATTTTCATC"
  compareStrings(string1, string2)

  ## Create a consensus matrix
  nw1 <-
    pairwiseAlignment(AAStringSet(c("HLDNLKGTF", "HVDDMPNAL")), AAString("SMDDTEKMSMKL"),
      substitutionMatrix = "BLOSUM50", gapOpening = -3, gapExtension = -1)
  consensusMatrix(nw1)

  ## Examine the consensus between the bacteriophage phi X174 genomes
  data(phiX174Phage)
  phageConsmat <- consensusMatrix(phiX174Phage, baseOnly = TRUE)
  phageDiffs <- which(apply(phageConsmat, 2, max) < length(phiX174Phage))
  phageDiffs
  phageConsmat[,phageDiffs]

  ## Read in ORF data
  file <- system.file("extdata", "someORF.fa", package="Biostrings")
  orf <- read.DNAStringSet(file, "fasta")

  ## To illustrate, the following example assumes the ORF data
  ## to be aligned for the first 10 positions (patently false):
  orf10 <- DNAStringSet(orf, end=10)
  consensusMatrix(orf10, baseOnly=TRUE, freq=TRUE)
  consensusString(sort(orf10)[1:5])

  ## For the character matrix containing the "exploded" representation
  ## of the strings, do:
  as.matrix(orf10, use.names=FALSE)