matchProbePair          package:Biostrings          R Documentation

_F_i_n_d "_t_h_e_o_r_e_t_i_c_a_l _a_m_p_l_i_c_o_n_s" _m_a_p_p_e_d _t_o _a _p_r_o_b_e _p_a_i_r

_D_e_s_c_r_i_p_t_i_o_n:

     In the context of a computer-simulated PCR experiment, one wants
     to find the amplicons mapped to a given primer pair. The
     'matchProbePair' function can be used for this: given a forward
     and a reverse probe (i.e. the chromosome-specific sequences of the
     forward and reverse primers used for the experiment) and a target
     sequence (generally a chromosome sequence), the 'matchProbePair'
     function will return all the "theoretical amplicons" mapped to
     this probe pair.

_U_s_a_g_e:

       matchProbePair(Fprobe, Rprobe, subject, algorithm="auto", logfile=NULL, verbose=FALSE)

_A_r_g_u_m_e_n_t_s:

  Fprobe: The forward probe. 

  Rprobe: The reverse probe. 

 subject: A DNAString object containing the target sequence. 

algorithm: One of the following: '"auto"', '"naive-exact"',
          '"naive-fuzzy"', '"boyer-moore"' or '"shift-or"'. See
          'matchPattern' for more information. 

 logfile: A file used for logging. 

 verbose: 'TRUE' or 'FALSE'. 

_D_e_t_a_i_l_s:

     The 'matchProbePair' function does the following: (1) find all the
     "plus hits" i.e. the Fprobe and Rprobe matches on the "plus"
     strand, (2) find all the "minus hits" i.e. the Fprobe and Rprobe
     matches on the "minus" strand and (3) from the set of all
     (plus_hit, minus_hit) pairs, extract and return the subset of
     "reduced matches" i.e. the (plus_hit, minus_hit) pairs such that
     (a) plus_hit <= minus_hit and (b) there are no hits (plus or
     minus) between plus_hit and minus_hit. This set of "reduced
     matches" is the set of "theoretical amplicons".

_V_a_l_u_e:

     A BStringViews object containing the set of "theoretical
     amplicons".

_A_u_t_h_o_r(_s):

     H. Pages

_S_e_e _A_l_s_o:

     'matchPattern', 'matchLRPatterns', 'findPalindromes',
     'reverseComplement', 'BStringViews'

_E_x_a_m_p_l_e_s:

       library(BSgenome.Dmelanogaster.FlyBase.r51)
       subject <- Dmelanogaster[["3R"]]

       ## With 20-nucleotide forward and reverse probes:
       Fprobe <- "AGCTCCGAGTTCCTGCAATA"
       Rprobe <- "CGTTGTTCACAAATATGCGG"
       matchProbePair(Fprobe, Rprobe, subject) # 1 "theoretical amplicons"

       ## With shorter forward and reverse probes, the risk of having multiple
       ## "theoretical amplicons" increases:
       Fprobe <- "AGCTCCGAGTTCC"
       Rprobe <- "CGTTGTTCACAA"
       matchProbePair(Fprobe, Rprobe, subject) # 2 "theoretical amplicons"
       Fprobe <- "AGCTCCGAGTT"
       Rprobe <- "CGTTGTTCACA"
       matchProbePair(Fprobe, Rprobe, subject) # 9 "theoretical amplicons"

