| blastSequences {annotate} | R Documentation |
This function sends a query to NCBI as a string of sequence or an entrez gene ID and then returns a series of MultipleAlignment objects.
blastSequences(x, database, hitListSize, filter, expect, program)
x |
A sequence as a character vector or an integer corresponding to an entrez gene ID. |
database |
Which NCBI database to use. |
hitListSize |
|
filter |
|
expect |
How many hits do you hope to get back, this will put a limit on the amount. |
program |
Which program do you want to use for blast. Default value is blastn. |
Right now the function only works for "blastn".
a series of MultipleAlignment objects of the appropriate type.
M. Carlson
## x can be an entrez gene ID blastSequences(17702) ## or x can be a sequence blastSequences(x = "GGCCTTCATTTACCCAAAATG") ## hitListSize does not promise that you will get the number of matches you ## want.. It will just try to get that many. blastSequences(x = "GGCCTTCATTTACCCAAAATG", hitListSize="20")